Adapters for the preparation of DNA libraries for Illumina NGS

Adapters for the preparation of DNA libraries for Illumina NGS

Sequencing random fragments of DNA is possible via the addition of short nucleotide sequences which allow any DNA fragment to:
1. Bind to a flow cell for next generation sequencing
2. Allow for PCR enrichment of adapter ligated DNA fragments only
3. Allow for indexing or 'barcoding' of samples so multiple DNA libraries can be mixed together into 1 sequencing lane (known as multiplexing)

During library preparation each DNA fragment gets and addional A overhang added to both ends.

The sequencing adapters are the following:
# TruSeq Universal Adapter:
5 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC*T 3
# TruSeq Indexed Adapter
5 P*GATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG 3

The stars indicate a phosphorothioate bond between the last C and T to prevent cleaving off the last T that is needed for annealing the overhang. The phosphate group on the indexed adapter is required to ligate the adapter to the DNA fragment.
The NNNNNN in the indexed adapter above represents the barcode. Reverse the indexed adapter and note how the last 12 bases are complementary.

Diagram of an adapter




P5 and P7 : Flow cell attachment sites
ID : Index
Adapter : Sequencing primer binding sites
DNA fragment : Insert

Ergebnis Ihrer Suche : 25 Produkt(e) gefunden

Grenzen Sie Ihre Suche ein :

RUOCE / IVD
  • kit 20
  • pcr products 5