Tissue Factor (F3) Human qPCR Primer Pair (NM_001993)

Cat# HP205750

Size : 200reactions

Request more information

Contact local distributor :


Phone :

Tissue Factor (F3) Human qPCR Primer Pair (NM_001993)

Specifications
Product Data
Locus ID 2152
Forward Sequence CAGAGTTCACACCTTACCTGGAG
Reverse Sequence GTTGTTCCTTCTGACTAAAGTCCG
ACCN NM_001993, NM_001993.1, NM_001993.2, NM_001993.3, NM_001993.4, BC011029, BC011029.1, BM769013, BM981095, BT019808, NM_001993.5
UniProt ID P13726
Synonyms CD142; TF; TFA
Components 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM.
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
Storage Store at -20°C.
Stability The primer mix is stable for one year from date of shipping.
Shipping Ambient