Neo1 Mouse Gene Knockout Kit (CRISPR)

CAT#: KN310902

Neo1 - mouse gene knockout kit via CRISPR, HDR mediated

Functional Cassette: GFP-puro Luciferase-Puro RFP-BSD mBFP-Neo



HDR-mediated knockout kit validation

Product Images

Specifications

Product Data
Format 2 gRNA vectors, 1 GFP-puro donor, 1 scramble control
Donor DNA GFP-puro
Symbol Neo1
Locus ID 18007
Components

KN310902G1, Neo1 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: GGAGGTGCAGAGGAGTCGCC

KN310902G2, Neo1 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: TGGCGGACAGCAGCGCCGGG

KN310902D, donor DNA containing left and right homologous arms and GFP-puro functional cassette.

GE100003, scramble sequence in pCas-Guide vector

Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_001042752, NM_008684
Synonyms 2610028H22Rik; AI327052; D930014N22Rik; Igdcc2

Documents

Other Versions