Cxcl5 Mouse Gene Knockout Kit (CRISPR)

CAT#: KN304047

Cxcl5 - mouse gene knockout kit via CRISPR, HDR mediated



HDR-mediated knockout kit validation

Product Images

Specifications

Product Data
Format 2 gRNA vectors, 1 GFP-puro donor, 1 scramble control
Donor DNA GFP-puro
Symbol Cxcl5
Locus ID 20311
Components

KN304047G1, Cxcl5 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: GTTCCATCTCGCCATTCATG

KN304047G2, Cxcl5 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: CTGCCGCAGCATCTAGCTGA

KN304047D, donor DNA containing left and right homologous arms and GFP-puro functional cassette.

GE100003, scramble sequence in pCas-Guide vector

Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_009141
UniProt ID P50228
Synonyms AMCF-II; Cxcl6; ENA-78; GCP-2; LIX; Scyb5; Scyb6
Summary This gene encodes a protein that is a member of the CXC subfamily of chemokines. Chemokines, which recruit and activate leukocytes, are classified by function (inflammatory or homeostatic) or by structure. This protein is proposed to bind the G-protein coupled receptor chemokine (C-X-C motif) receptor 2 to recruit neutrophils and to have homeostatic and inflammatory functions. In mouse, deficiency of this gene is associated with increased lung inflammation that is neutrophil-dependent. [provided by RefSeq, May 2013]

Documents

Other Versions