Trpc6 Mouse Gene Knockout Kit (CRISPR)

CAT#: KN318295

Trpc6 - mouse gene knockout kit via CRISPR, HDR mediated



HDR-mediated knockout kit validation

Product Images

Specifications

Product Data
Format 2 gRNA vectors, 1 GFP-puro donor, 1 scramble control
Donor DNA GFP-puro
Symbol Trpc6
Locus ID 22068
Components

KN318295G1, Trpc6 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: AGTCCTGGCTCTCGTTGCGC

KN318295G2, Trpc6 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: GCCCGAGGTTCGTGACCCGG

KN318295D, donor DNA containing left and right homologous arms and GFP-puro functional cassette.

GE100003, scramble sequence in pCas-Guide vector

Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_001282086, NM_001282087, NM_013838
UniProt ID Q61143
Synonyms AV025995; LLHWJM002; LLHWJM003; LLHWJM004; mtrp6; TRP-6; Trrp6
Summary Thought to form a receptor-activated non-selective calcium permeant cation channel. Probably is operated by a phosphatidylinositol second messenger system activated by receptor tyrosine kinases or G-protein coupled receptors. Activated by diacylglycerol (DAG) in a membrane-delimited fashion, independently of protein kinase C. Seems not to be activated by intracellular calcium store depletion.[UniProtKB/Swiss-Prot Function]

Documents

Other Versions