SARS-CoV-2 ORF8 Gene cDNA Clone (Native Sequence)

Katalog-Nummer VC202562

Size : 10µg

Weitere Informationen anfordern

Contact local distributor :


Telefonnummer :

SARS-CoV-2 ORF8 Gene cDNA Clone (Native Sequence)

SKU
VC202562
Native cDNA clone for SARS-CoV-2 ORF8 protein [Severe acute respiratory syndrome coronavirus 2], YP_009724396

Expression-ready ORF plasmid with C-terminal tag(s)

Click here to learn more.

Bulk Requests & Clone Modifications
Specifications
Product Data
Target Symbol ORF8
Vector pUCminusMCS
E. coli Selection Ampicillin
Mammalian Cell Selection None
Sequence Data
ORF Nucleotide Sequence
>The Viral ORF clone VC202562 represents NCBI reference of YP_009724396 for cloning vector
Blue=ORF Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAAATTTCTTGTTTTCTTAGGAATCATCACAACTGTAGCTGCATTTCACCAAGAATGTAGTTTACAG
TCATGTACTCAACATCAACCATATGTAGTTGATGACCCGTGTCCTATTCACTTCTATTCTAAATGGTAT
ATTAGAGTAGGAGCTAGAAAATCAGCACCTTTAATTGAATTGTGCGTGGATGAGGCTGGTTCTAAATCA
CCCATTCAGTACATCGATATCGGTAATTATACAGTTTCCTGTTTACCTTTTACAATTAATTGCCAGGAA
CCTAAATTGGGTAGTCTTGTAGTGCGTTGTTCGTTCTATGAAGACTTTTTAGAGTATCATGACGTTCGT
GTTGTTTTAGATTTCATCTAA

ACCN NC_045512
ORF Size 276 bp
OTI Annotation This clone was engineered to express the complete ORF. Expression varies depending on the nature of the gene.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NC_045512.2, YP_009724396
RefSeq ORF 276 bp
MW 13.8 kDa