Ccl2 (NM_011333) Mouse Untagged Clone

CAT#: MC209362

Ccl2 (untagged) - Mouse chemokine (C-C motif) ligand 2 (Ccl2), (10ug)

Datasheet
SDS

Product Images

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Ccl2
Synonyms AI323594; HC11; JE; MCA; MCAF; MCP; MCP-; MCP-1; MCP1; Scy; Scya2; Sig; Sigje; SMC-C; SMC-CF
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209362 representing NM_011333
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCAGGTCCCTGTCATGCTTCTGGGCCTGCTGTTCACAGTTGCCGGCTGGAGCATCCACGTGTTGGCTC
AGCCAGATGCAGTTAACGCCCCACTCACCTGCTGCTACTCATTCACCAGCAAGATGATCCCAATGAGTAG
GCTGGAGAGCTACAAGAGGATCACCAGCAGCAGGTGTCCCAAAGAAGCTGTAGTTTTTGTCACCAAGCTC
AAGAGAGAGGTCTGTGCTGACCCCAAGAAGGAATGGGTCCAGACATACATTAAAAACCTGGATCGGAACC
AAATGAGATCAGAACCTACAACTTTATTTAAAACTGCATCTGCCCTAAGGTCTTCAGCACCTTTGAATGT
GAAGTTGACCCGTAAATCTGAAGCTAATGCATCCACTACCTTTTCCACAACCACCTCAAGCACTTCTGTA
GGAGTGACCAGTGTGACAGTGAACTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_011333
Insert Size 447 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at info@biotrend.com

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_011333.3, NP_035463.1
RefSeq Size 806 bp
RefSeq ORF 447 bp
Locus ID 20296
UniProt ID P10148
Cytogenetics 11 49.82 cM
Gene Summary This gene is one of several cytokine genes clustered on chromosome 11. Chemokines are a superfamily of secreted proteins involved in immunoregulatory and inflammatory processes. The superfamily is divided into four subfamilies based on the arrangement of N-terminal cysteine residues of the mature peptide. This chemokine is a member of the CC subfamily which is characterized by two adjacent cysteine residues. This cytokine displays chemotactic activity for monocytes and memory T cells but not for neutrophils. The human ortholog has been implicated in the pathogenesis of diseases characterized by monocytic infiltrates, such as psoriasis, rheumatoid arthritis, and atherosclerosis. [provided by RefSeq, Sep 2015]

Other Versions

SKU Description Size
MG226804 Ccl2 (tGFP-tagged) - Mouse chemokine (C-C motif) ligand 2 (Ccl2), (10ug)
    • 10 ug

350,00 EUR

MR226804 Ccl2 (Myc-DDK-tagged) - Mouse chemokine (C-C motif) ligand 2 (Ccl2)
    • 10 ug

150,00 EUR

MR226804L3 Lenti ORF clone of Ccl2 (Myc-DDK-tagged) - Mouse chemokine (C-C motif) ligand 2 (Ccl2)
    • 10 ug

450,00 EUR

MR226804L4 Lenti ORF clone of Ccl2 (mGFP-tagged) - Mouse chemokine (C-C motif) ligand 2 (Ccl2)
    • 10 ug

450,00 EUR